Madanswer Technologies Interview Questions Data|Agile|DevOPs|Python - Recent questions in TypeScript - JavaScript's Superset

How to generate TypeScript definition file from any .ts file?

Wed, 23 Mar 2022 03:07:43 +0000

How to generate TypeScript definition file from any .ts file?

What is TypeScript Declare Keyword?

Wed, 23 Mar 2022 03:07:08 +0000

What is TypeScript Declare Keyword?

What is TypeScript Definition Manager and why do we need it?

Wed, 23 Mar 2022 03:06:12 +0000

What is TypeScript Definition Manager and why do we need it?

Is it possible to debug any TypeScript file?

Wed, 23 Mar 2022 03:05:38 +0000

Is it possible to debug any TypeScript file?

Does TypeScript supports function overloading as JavaScript doesn't support function overloading?

Wed, 23 Mar 2022 03:02:39 +0000

Does TypeScript supports function overloading as JavaScript doesn't support function overloading?

How does TypeScript support optional parameters in function as in JavaScript every parameter is optional for a function?

Wed, 23 Mar 2022 03:01:57 +0000

How does TypeScript support optional parameters in function as in JavaScript every parameter is optional for a function?

What is default visibility for properties/methods in TypeScript classes?

Wed, 23 Mar 2022 03:01:34 +0000

What is default visibility for properties/methods in TypeScript classes?

What are Mixins?

Wed, 23 Mar 2022 03:01:08 +0000

What are Mixins?

Explain Decorators in Typescript?

Wed, 23 Mar 2022 03:00:30 +0000

Explain Decorators in Typescript?

What is namespace in Typescript? How to declare a namespace in Typescript?

Wed, 23 Mar 2022 02:59:50 +0000

What is namespace in Typescript? How to declare a namespace in Typescript?

What is the difference between the internal module and the external module?

Wed, 23 Mar 2022 02:53:37 +0000

What is the difference between the internal module and the external module?

What are the Modules in Typescript?

Wed, 23 Mar 2022 02:52:50 +0000

What are the Modules in Typescript?

How do you implement inheritance in TypeScript?

Wed, 23 Mar 2022 02:52:10 +0000

How do you implement inheritance in TypeScript?

How to Call Base Class Constructor from Child Class in TypeScript?

Wed, 23 Mar 2022 02:51:42 +0000

How to Call Base Class Constructor from Child Class in TypeScript?

Which object oriented terms are supported by TypeScript?

Wed, 23 Mar 2022 02:51:08 +0000

Which object oriented terms are supported by TypeScript?

Is Native Javascript supports modules?

Wed, 23 Mar 2022 02:50:43 +0000

Is Native Javascript supports modules?

What do you understand by classes in Typescript? List some features of classes.

Wed, 23 Mar 2022 02:50:00 +0000

What do you understand by classes in Typescript? List some features of classes.

What do you mean by interfaces? Explain them with reference to Typescript.

Wed, 23 Mar 2022 02:49:27 +0000

What do you mean by interfaces? Explain them with reference to Typescript.

Is it possible to compile .ts automatically with real-time changes in the .ts file?

Wed, 23 Mar 2022 02:48:45 +0000

Is it possible to compile .ts automatically with real-time changes in the .ts file?

List out the built-in data types in TypeScript.

Tue, 22 Mar 2022 05:21:37 +0000

List out the built-in data types in TypeScript.

What are the different types of TypeScript?

Tue, 22 Mar 2022 05:21:07 +0000

What are the different types of TypeScript?

Can we combine multiple .ts files into a single .js file?

Tue, 22 Mar 2022 05:20:21 +0000

Can we combine multiple .ts files into a single .js file?

How do you compile TypeScript files?

Tue, 22 Mar 2022 05:19:36 +0000

How do you compile TypeScript files?

How to install TypeScript?

Tue, 22 Mar 2022 05:17:42 +0000

How to install TypeScript?

Who developed Typescript and what is the current stable version available?

Tue, 22 Mar 2022 05:17:14 +0000

Who developed Typescript and what is the current stable version available?

What are the Components of TypeScript?

Tue, 22 Mar 2022 05:16:24 +0000

What are the Components of TypeScript?

What are the Disadvantages of TypeScript?

Tue, 22 Mar 2022 05:15:37 +0000

What are the Disadvantages of TypeScript?

What are the Benefits of using TypeScript?

Tue, 22 Mar 2022 05:14:49 +0000

What are the Benefits of using TypeScript?

Why do we need TypeScript?

Tue, 22 Mar 2022 05:12:14 +0000

Why do we need TypeScript?

What is TypeScript?

Tue, 22 Mar 2022 05:10:35 +0000

What is TypeScript?

What are the Differences between TypeScript and JavaScript?

Tue, 22 Mar 2022 05:09:17 +0000

What are the Differences between TypeScript and JavaScript?

TypeScript is a __________.

Tue, 22 Mar 2022 04:29:43 +0000

TypeScript is a __________.

a) New version of JavaScript

b) Compiler

c) Dynamically type-checked language

d) Super-set of JavaScript

Which of the two is used appropriately in JavaScript code:

Tue, 22 Mar 2022 04:25:26 +0000

Which of the two is used appropriately in JavaScript code:

a) function reverse(s: string) : string;

b) function reverse (s: String) : String;

TypeScript Interview Questions and Answers MCQs

Tue, 22 Mar 2022 03:59:26 +0000

TypeScript - JavaScript's Superset FrescoPlay MCQs Answers

TypeScript Quiz on TypeScript Grammar

TypeScript Quiz on Data Types

javascript-interview-questions,

typescript-programming-questions,

typescript-practice-problems,

typescript-interview-questions-github,

typescript-tutorial,

typescript-quiz,

angular-interview-questions,

typescript-interview-questions-and-answers-2021

Generics allows accepting arguments of _________.

Mon, 27 Jan 2020 08:41:31 +0000

Generics allows accepting arguments of _________.

a) Only one type

b) None of the options

c) Different types

Which of the following is/are inherited from base class?

Mon, 27 Jan 2020 08:34:20 +0000

Which of the following is/are inherited from base class?

a) method

b) Both the options

c) variables

Which keyword is used for Inheritance in TypeScript?

Mon, 27 Jan 2020 08:33:47 +0000

Which keyword is used for Inheritance in TypeScript?

a) follows

b) extends

c) defines

d) implements

The code snippet " if (value && typeof value == "string") {}; is used for ______________.

Mon, 27 Jan 2020 08:32:26 +0000

The code snippet " if (value && typeof value == "string") {}; is used for ______________.

a) Parameterising

b) Inheritance add-on

c) Overriding

d) Overloading

Which keyword is used to access base class properties?

Mon, 27 Jan 2020 08:31:18 +0000

Which keyword is used to access base class properties?

a) super

b) extends

c) base

d) implements

TypeScript uses prototypical inheritance instead of classical inheritance.

Mon, 27 Jan 2020 08:30:31 +0000

TypeScript uses prototypical inheritance instead of classical inheritance.

a) True

b) False

Which of the options is used appropriately in JavaScript code?

Mon, 27 Jan 2020 08:29:57 +0000

Which of the options is used appropriately in JavaScript code?

a) function reverse(s: string) : string;

b) function reverse (s: String) : String;

value && typeof value == "DataType" is used for _________.

Mon, 27 Jan 2020 08:29:17 +0000

value && typeof value == "DataType" is used for _________.

a) Overloading

b) Type annotation

c) Overriding

d) Inheritance

The following are correct ways of defining variables in TypeScript, except _________.

Mon, 27 Jan 2020 08:28:11 +0000

The following are correct ways of defining variables in TypeScript, except _________.

a) var NumberOfDNA=10231

b) var DNA:string

c) var DNA:string= "CGATAATCGGGGAATTTCAG"

d) var 10231

Syntax for a decorator is _________.

Mon, 27 Jan 2020 08:27:43 +0000

Syntax for a decorator is _________.

a) @symbol

b) ?symbol{}

c) *(symbol)

d) #symbol

Inheritance is implemented by using the ________ keyword.

Mon, 27 Jan 2020 08:27:06 +0000

Inheritance is implemented by using the ________ keyword.

a) implements

b) extends

c) namespace

d) None of the options

" var jarvis = function (x: number, y?: number): number {} " showcases _________.

Mon, 27 Jan 2020 08:26:32 +0000

" var jarvis = function (x: number, y?: number): number {} " showcases _________.

a) Defining Parameter

b) Both the options

c) Type annotation

Generics is a/an _______.

Mon, 27 Jan 2020 08:25:55 +0000

Generics is a/an _______.

a) Class

b) Object

c) Template

d) Functions

Which of the following is the right way of defining enum?

Mon, 27 Jan 2020 08:25:17 +0000

Which of the following is the right way of defining enum?

a) enum Enum {}

b) const enum DNA {}

c) declare enum Enum {}

d) All the options

A type system is a set of ________.

Mon, 27 Jan 2020 08:10:12 +0000

A type system is a set of ________.

a) Predefined Functions

b) Data

c) Rules

d) Variables

Type Annotations allow us to _______.

Mon, 27 Jan 2020 08:09:37 +0000

Type Annotations allow us to _______.

a) Cast a reference of a base class to one of its derived classes

b) Record the intended contract of the function or variable

c) Cast to a supertype

d) Reassign the type of data